circad | circRNAs associated with diseases

FLI1 exonic circular RNA
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink		PMID	30537986
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Human breast cancer cell lines (MDA-MB231, MCF7, SKBR3, T47D, BT474, ZR751)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CTGTTGTCACACCTCAGTTAC Reverse CATGTTATTGCCCCAAGCTCCTC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Chen, N, Zhao, G, Yan, X, Lv, Z, Yin, H, Zhang, S, Song, W, Li, X, Li, L, Du, Z, Jia, L, Zhou, L, Li, W, Hoffman, AR, Hu, JF, Cui, J (2018). A novel FLI1 exonic circular RNA promotes metastasis in breast cancer by coordinately regulating TET1 and DNMT1. Genome Biol., 19, 1:218.